Research ArticleBiological & Life SciencesOpen Access · CC BY 4.0

Calcite Precipitation & Its Effect on the Stability of Earthen Bricks

P. Kavitha*Department of Microbiology, Sir Syed Institute for Technical Studies, Kannur University, Kannur, Kerala, India

* Corresponding author

Published in: Vol. 2, No. 1 (2026)Article: 4Pages: 11–19Published: 17 July 2026

Abstract

The calcite-precipitating Streptomyces sp. KRA01 was isolated from the gut of termites inhabiting red loamy soil in Kannur District, Kerala, India. The isolate was confirmed through biochemical tests and molecular sequencing and was designated Streptomyces sp. KRA01; the nucleotide sequence was submitted to GenBank under accession no. MW186183. The application of microbiological methods to improve the mechanical properties of soil is known as microbial geotechnology. In this research, microbes were isolated from the termite gut, analysed and identified as Streptomyces sp. KRA01. The objective of this study was to demonstrate the soil stabilization capacity of Streptomyces sp. KRA01 through microbial geotechnology. The microbes grew well in nutrient broth supplemented with carbon, nitrogen and inorganic sources acting as their nutrient sources. Microbially stabilized mud blocks (MSMB) were prepared using red loamy soil and microbial culture and cured by spraying an optimized nutrient medium for 28 days. The compressive strength of a microbially treated mud block was found to be higher than that of the conventional brick. It was discovered that biomineralized calcium carbonate in bacterial cells contributed to the improvement in strength. The results showed that the rate of water absorption was significantly reduced in the brick stabilized with microbes, suggesting that microbial activities can significantly improve the mechanical properties of MSMB. Calcite precipitation by Streptomyces sp. KRA01 significantly reduced water absorption by the earthen brick. Hence, microbial isolates can be used as additives to stabilize soil. If the technology is tested and found to be successful, it might lead to longer maintenance-free periods, reduced material demand, an increased level of service and the preservation of nature.

Keywords

1. Introduction

Construction with earthen bricks is a common practice among communities in developing countries, as it is affordable and economical, and has high strength. Production of earthen bricks requires less energy than production of other bricks. Apart from these benefits, adobe stores heat in winter and transmits heat in summer, which helps maintain the indoor temperature. These benefits fulfil the requirements of an adequate house, which is why earthen construction has been adopted by 50% of the world’s population (Smith & Austin, 1989). Cement plants contribute 5% of the world’s carbon dioxide emissions, which are the primary factor in global warming. Since there is no practical way to recycle cement, every new structure and road requires brand-new cement (Andres et al., 1997). Thus, earthen bricks have advantages over cement bricks, as they are the more environmentally friendly option. The application of microbial geotechnology can improve the strength, texture, voids and water-resisting properties of the brick. The natural properties of soil can be altered through the process of soil stabilization. Soil stabilization is the process of modifying the strength, texture, voids and water-resisting properties of soil to make it compatible with a particular application (Ivanov & Chu, 2008). Some microbes have the capacity to modify soil properties.

Bacteria-induced calcite precipitation (BCP) is the term for calcite synthesis under supersaturation conditions and at temperatures that, owing to the presence of bacterial cells and their metabolic activity, induce reactions that produce a variety of calcium carbonate polymorphs (Ferral Pérez & Galicia García, 2020). Organisms can secrete one or more metabolic products that react with divalent cations in their environment, resulting in mineral precipitation. Four fundamental components have the greatest impact on BCP: calcium carbonate content, dissolved inorganic carbon concentration, pH and the availability of nucleation sites (Anbu et al., 2016; Yoshida et al., 2010). BCP technology can be employed to solve a variety of medicinal, environmental (heavy metal remediation, radionuclide remediation and CO2 sequestration) and engineering (biocementation and bioconsolidation) challenges (Achal et al., 2013). More recently, BCP has gained attention for innovative self-healing technologies in the fields of geotechnical engineering, earth science and building materials. The stabilization of soil by boosting its strength and decreasing its compressibility is one of the few well-known uses of BCP in the geotechnical and geoenvironmental disciplines. Until now, many bacteria have been used to illustrate the molecular mechanisms involved in calcite precipitation with different morphologies (Arias et al., 2019; Ferral Pérez & Galicia García, 2020; Kim et al., 2016; Seifan et al., 2016). Typically, the type of bacterium selected for BCP depends on the specific function and environmental factors. Sporosarcina pasteurii (Gollapudi et al., 1995), Bacillus spp. (Sánchez-Navas et al., 2009), Pseudomonas aeruginosa (Li et al., 2015) and Arthrobacter spp. (Rusznyák et al., 2012) are frequently used in BCP. Bacteria that produce biomolecules capable of altering the environment and promoting the precipitation of minerals are used in the biocementation process. These bacteria produce urease, which can result in the production of metabolites such as CO2 and NH3, which can combine with Ca2+ to form calcite (Dhami et al., 2013). Calcite precipitation by the bacteria mentioned above occurs in monuments, caves, sediments and constructions. The function and structure of biofilm geometry and exopolymeric substances (EPS) explain how these bacteria nucleate Ca2+ and synthesize minerals (Dupraz et al., 2009).

2. Materials and Methods

2.1. Isolation and screening of calcite-producing bacteria

The soil samples were collected from termite guts in Kannur (Kerala), India, in sterile polythene bags and transported to the laboratory. The serially diluted samples were plated on nutrient agar medium and observed for morphologically different colonies at 37 °C for 7 days. Five morphologically different colonies (KRA01–KRA05) were cultured on nutrient agar and screened for calcite production using a standard protocol (Mahanty et al., 2013). For the rapid detection and isolation of calcite-producing bacteria, precipitation of calcium carbonate was assessed via titration with hydrochloric acid. The pure culture of the producer strain was designated KRA01. The morphology of the calcite producer was further confirmed by scanning electron microscopy (Arya et al., 2016).

2.2. Measurement of dry biomass

The culture was centrifuged at 10,000 rpm for 15 minutes in order to quantify dry biomass, and the pellet was dried to constant weight at 55 °C in an oven.

2.3. Biochemical and molecular identification of calcite producer KRA01

The calcite-producing strain KRA01 was characterized by studying its colony morphology and biochemical characteristics in accordance with Bergey’s Manual of Determinative Bacteriology. 16S rRNA studies were carried out to confirm the species-level identification of KRA01. The DNA of KRA01 was isolated using the CTAB method and amplified using the universal forward and reverse primers 3′ AGGCCCGGAACGTATTCACC 5′ and 16R 3′ GTGCCAGCAGCCGCGGTAAT 5′. The PCR-amplified product was sequenced using the BigDye Terminator (BDT) v3.1 cycle sequencing kit on an ABI 3730xl Genetic Analyzer. The sequenced product was subjected to BLAST analysis to identify the nearest homology, and a phylogenetic tree was drawn using MEGA 10.0 software. The evolutionary history was inferred by using the maximum likelihood method and the Tamura–Nei model. The bootstrap consensus tree inferred from 500 replicates is taken to represent the evolutionary history of the taxa analysed.

2.4. Calcium carbonate precipitation

Precipitation of calcium carbonate was assessed via titration with hydrochloric acid using approximately 10 g of randomly subsampled soil from the column. The soil taken for titration was not air-dried, as described by Rajasekar et al. (2018). Before this procedure, the sand was washed with distilled water to remove excess or unused calcium chloride, urea and any other by-products, such as hydrochloric acid, that may have been retained in the sand. The steps are as follows: put a 1–10 g (0.001 g) soil sample into a 250 mL Erlenmeyer flask, add 20 mL of standardized 1 N HCl using a volumetric pipette, cover the Erlenmeyer flask with a watch glass, and boil the soil–acid mixture for 5 minutes before adding 50–100 mL of deionized water using a graduated cylinder. After the mixture has cooled, add 2 or 3 drops of phenolphthalein indicator. Titrate the solution with 1 N NaOH while swirling the flask, and record the reading when a faint pink colour develops (Rajasekar et al., 2021).

(1)

2.5. Effect of culture conditions on the production of calcite

The effects of incubation temperature, pH, and carbon and nitrogen sources were determined. The growth of strain KRA01 in relation to the production of calcite in nutrient medium under different culture conditions was also determined. The growth of strain KRA01 was monitored by measuring the absorbance of aliquots at 610 nm (OD610) using a UV–visible double-beam spectrophotometer (HLS1-19191, India) every 24 h for 6 days. The cultures grown for calcite precipitation were evaluated by volumetric methods.

The effect of temperature and pH on the growth of the strain was determined by culturing KRA01 at various temperatures (25, 30, 37 and 40 °C) and at pH values adjusted to 5.0, 6.0, 7.0, 8.0 and 9.0 using 1 N HCl/1 N NaOH, in Davis minimal broth and nutrient broth, respectively, in separate experimental set-ups.

2.6. Effect of carbon source, nitrogen source and inorganic salt on calcite production

To determine the best carbon source for calcite production, 100 mL of sterile nutrient medium containing 1% (w/v) of different carbon sources (sucrose, lactose, starch and sago rice powder; pH 7.0) was inoculated with 10 mL of inoculum and incubated for 72 h at 37 °C after sterilization. The growth, dry weight and calcite production were estimated as described previously.

The effect of nitrogen source on calcite production was determined by supplementing 100 mL of production medium with different nitrogen sources (1% w/v), viz. ammonium sulfate, beef extract, malt extract and green gram powder, with the pH adjusted to 7.0; 10% inoculum was added to the sterilized media, which were incubated for 72 h at 37 °C, following which growth, dry weight and calcite precipitation were estimated.

2.7. Preparation of bacterial earthen bricks

Nutrient broth with additional carbon, nitrogen and inorganic sources was inoculated with KRA01. The log-phase bacterial culture and clay were mixed in a 1:1 ratio, and a brick measuring 15 × 6.8 × 3.5 cm was prepared and baked in a kiln at temperatures ranging from 900 °C to 1200 °C. A brick that was prepared using a conventional method served as a control. Bricks must cure in order to become strong and long-lasting. For 28 days, the bricks were sprayed with nutrient medium and wrapped with cotton fabric in order to cure. Calcite precipitation caused by microbes is enhanced by curing (Arya et al., 2016).

3. Results and Discussion

3.1. Isolation and screening of calcite-producing bacteria

Of the five distinct strains of bacteria isolated from the soil sample, strain KRA01 produced calcite, as revealed by the calcium precipitation test. The calcite-producing strain KRA01 was confirmed as Streptomyces sp. KRA01 based on its morphological, biochemical and molecular characteristics. The isolated calcite-producing strain Streptomyces sp. KRA01 is shown in Fig. 1.

Photograph of an agar plate showing whitish filamentous bacterial colony growth in streaks, beside an empty transparent Petri dish lid on a dark surface.
Fig. 1. Isolation of the calcite-producing strain Streptomyces sp. KRA01 on an agar plate

3.2. Biochemical and molecular identification of calcite producer KRA01

The strain was identified by its biochemical properties as a long, filamentous, Gram-positive bacterium that can form chains of globose, smooth-surfaced spores that are straight to flexuous (Rectiflexibiles). A phylogenetic tree was created with MEGA 10.0 software. The gene sequence was submitted to GenBank and assigned the accession number MW186183. Streptomyces species are catalase-positive and indole-negative, and can utilize glucose as their carbon source. Interestingly, most of the hydrogen sulfide producers came from the dumpsite, which is known to contain alternative sources of nutrients (e.g., food waste, paper, plastic) for microbial use, with hydrogen sulfide as an end product (Ko et al., 2015; Tsuchida et al., 2011). In addition, Long et al. (2016) reported that the accumulation of hydrogen sulfide may cause an increase in soil pH, which favours the growth of Streptomyces. This could likewise explain the abundance of Streptomyces isolated from dumpsites, as seen in this study (Antido & Climacosa, 2022).

3.3. Calcium carbonate precipitation

By titrating the bacteria-containing soil columns against the control soil column, the percentage of CaCO3 in each was determined (Table 1; Fig. 2). In comparison with 15% for the control sample, the CaCO3 percentage generated by the microbially induced calcite precipitation (MICP) process varied from 15% in Kerala and Tamil Nadu soil to 0% by the microbe. A larger difference in CaCO3 was anticipated, given the measured differences in permeability and strength. From a scientific standpoint, this variation indicates that the organism’s distribution of CaCO3 production plays a crucial role in the modification of permeability and strength. In order to confirm whether the cultivable moonmilk Streptomyces could indeed produce mineral deposits, we selected two phylotype representatives to be investigated first by polarized light microscopy and then by ESEM in low-vacuum mode for the presence of calcium carbonate precipitates. The selection of strains was based on their predisposition for CaCO3 precipitation, as judged by the sum of the metabolic performance observed for ureolysis and peptide/amino acid ammonification—the two most significant activities observed for moonmilk Streptomyces (Maciejewska et al., 2017).

Table 1. Effect of culture conditions on the production of calcite
S. No.SampleSoilTemperature (°C)pHCalcite precipitationPercentage
253740567
1Tamil Nadu10 g1.250.940.721.460.840.76Pink15
2Kerala10 g0.910.630.320.670.540.44No colour change
3Control10 g1.150.960.760.970.460.45Pink15
Photograph of three foil-capped Erlenmeyer flasks containing brown, pink-red and light orange liquid cultures after the calcium carbonate precipitation test.
Fig. 2. Microbially induced calcium carbonate precipitation

3.4. Growth kinetics of Streptomyces sp. KRA01

After reaching its peak growth in the nutrient medium at 25 °C and pH 5 at the 72nd hour of incubation (OD610 = 1.02±0.052; calcite precipitation: 15%), the calcite-producing strain Streptomyces sp. KRA01 started to decline (Table 2). According to Yun et al. (2018), the growth of the Streptomyces strain was found to occur within a pH range of 6–8, with optimum growth at pH 7 and 28 °C. Actinobacteria, in particular, have been proposed to play a role in the formation of moonmilk deposits by acting as nucleation sites for carbonate deposition (Cañaveras et al., 2006). Classical SEM observations showed the same crystal morphologies that have also been reported in the literature, regardless of the fixation method used—glutaraldehyde, ethanol or freeze-drying (Bindschedler et al., 2010; Cañaveras et al., 1999).

Table 2. Growth kinetics of Streptomyces sp. KRA01 at different temperatures and pH values
Temperature (°C)Growth (OD610)pHGrowth (OD610)Calcite precipitationPercentage
251.02±0.05251.23±0.015Pink colour change15
301.21±0.08560.95±0.011
370.94±0.01570.48±0.38
400.78±0.04580.01±0.01

3.5. Effect of temperature on growth and production of biomass by Streptomyces sp. KRA01

Grown at various temperatures ranging from 25 to 40 °C, the strain Streptomyces sp. KRA01 demonstrated optimal growth at 30 °C, exhibiting an OD value of 1.21±0.085 and dry mass production of 3.23±0.208 g/L (Table 3). Related findings were noted for Streptomyces isolates from each soil habitat examined in this study. We observed that more Streptomyces species were isolated from soil habitats (e.g., dumpsite and garden) at higher altitudes, with slightly acidic to alkaline pH and temperatures ranging from 29 to 33 °C, which is consistent with the reported optimum conditions that support Streptomyces growth (Antido & Climacosa, 2022; Barka et al., 2016; Goodfellow et al., 2012).

Table 3. Effect of temperature on growth and production of biomass by Streptomyces sp. KRA01
Temperature (°C)Growth (OD610)Dry biomass (g/L)
251.02±0.0524.9±0.230
301.21±0.0853.23±0.208
370.94±0.0157.16±0.251
400.78±0.0458.13±0.351

3.6. Effect of pH on growth and production of biomass by Streptomyces sp. KRA01

The strain’s growth and dry mass production were found to be optimal at pH 7, with an OD value of 1.23±0.015 and a dry mass yield of 8.37±0.208 g/L (Table 4). Ten environmental Streptomyces spp. were grown and sporulated between pH 4.0 and 11.5, at intervals of 1.5, on starch–casein–KNO3, tryptone–yeast extract–glucose, glycerol–arginine and tryptone–soy agars, and on three of their modifications (Kontro et al., 2005).

Table 4. Effect of pH on growth and production of biomass by Streptomyces sp. KRA01
pHGrowth (OD610)Dry biomass (g/L)
50.48±0.382.97±0.493
60.95±0.0114.47±0.251
71.23±0.0158.37±0.208
80.01±0.016.2±0.3

3.7. Effect of carbon source on growth and production of biomass by Streptomyces sp. KRA01

In Streptomyces sp. KRA01, jaggery as a carbon source induced a dry mass of 8.83±0.230. When different carbon sources were added to the media, growth on jaggery (183±0.0017) was the highest (Table 5). This result was consistent with the study conducted by Pridham and Gottlieb (1948), as the strain’s wide capacity for carbon assimilation was demonstrated by its use of a variety of carbon sources. Valine, D-galactose, α-lactose, soluble starch and anhydrous lactose were among the carbon sources that the strain effectively used. The taxonomic characterization of actinomycetes is significantly influenced by their utilization of carbohydrates (Yun et al., 2018).

Table 5. Effect of carbon source on growth and production of biomass by Streptomyces sp. KRA01
Carbon sourceOD valueDry mass
Jaggery183±0.00178.83±0.230
Sugarcane1.33±0.0408.93±0.251
Toddy juice0.085±0.00404.27±0.208
Toddy sugar0.72±0.0026.53±0.152

3.8. Effect of inorganic salt on growth and production of biomass by Streptomyces sp. KRA01

Of a variety of inorganic and organic sources, the maximum growth (2.73±0.21) was supported by sodium chloride, followed by yogurt and calcium carbonate (Table 6). According to published research, NaCl is the ideal inorganic source for microbial growth. This outcome is consistent with the study by Bhavana et al. (2014), which found that 7.5 g/L of NaCl was the ideal concentration needed to produce antimicrobial compounds. A further increase in NaCl concentration resulted in a sharp decline in mycelial growth and antimicrobial compound production.

Table 6. Effect of inorganic salt on growth and production of biomass by Streptomyces sp. KRA01
Inorganic saltOD valueDry mass
Calcium carbonate0.87±0.060.79±0.08
NaCl2.73±0.212.33±0.15
Yogurt3.17±0.255.2±0.36

3.9. Effect of nitrogen source on growth and production of biomass by Streptomyces sp. KRA01

This section summarizes the different nitrogen sources that contributed to the results obtained. The results showed that while Streptomyces sp. KRA01 could grow on soybean and green gram, it could not grow on chebulic myrobalan or corn steep liquor. As a result, it was found that the medium with soybean as the sole nitrogen supplement supported high growth. The inorganic sources in the medium were found to have a significant impact on the growth of Streptomyces sp. KRA01. Of all the inorganic sources used, yogurt supported the fastest rate of growth (Table 6).

3.10. Preparation of bacterial earthen bricks

For the bacterial earthen bricks, Streptomyces sp. KRA01 was inoculated into nutrient broth containing additional carbon, nitrogen and inorganic sources. A brick measuring 15 × 6.8 × 3.5 cm was made and baked in a kiln at 900 °C to 1200 °C using a 1:1 mixture of clay and bacterial culture at log phase. A brick made in the traditional manner served as the control. In porous soil, the microbially induced precipitation of CaCO3 is typically achieved by the addition of the exogenous bacterium Streptomyces sp. KRA01. CaCO3 deposition around the surfaces of the soil particles or in the void spaces causes the porous medium to become clogged, which lowers the porosity of the material. Recent studies have investigated waste products such as fly ash, rice husk ash and waste stone. The use of microbially induced calcite precipitation to improve soil shear strength and minimize hydraulic conductivity has been demonstrated. Increased soil strength can help to increase ground bearing capacity, while decreased hydraulic conductivity can help to reduce settlement, shrink–swell propensity, seepage and rainfall penetration into soils. In the experiments, MICP was found to be more effective in improving shear strength in residual soil than in sand (Krishna Kumari et al., 2021).

References

  1. Achal, V., Pan, X., Lee, D.-J., Kumari, D., & Zhang, D. (2013). Remediation of Cr(VI) from chromium slag by biocementation. Chemosphere, 93(7), 1352–1358. https://doi.org/10.1016/j.chemosphere.2013.08.008
  2. Anbu, P., Kang, C.-H., Shin, Y.-J., & So, J.-S. (2016). Formations of calcium carbonate minerals by bacteria and its multiple applications. SpringerPlus, 5, Article 250. https://doi.org/10.1186/s40064-016-1869-2
  3. Andres, R. J., Marland, G., Fung, I., & Matthews, E. (1997). Geographic patterns of carbon dioxide emissions from fossil-fuel burning, hydraulic cement production, and gas flaring on a one degree by one degree grid cell basis: 1950 to 1990 (A. L. Brenkert, Ed.; Report No. ORNL/CDIAC-97, NDP-058; Environmental Sciences Division Publication No. 4646). Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory. https://doi.org/10.2172/666249
  4. Antido, J. W. A., & Climacosa, F. M. M. (2022). Enhanced isolation of Streptomyces from different soil habitats in Calamba City, Laguna, Philippines using a modified integrated approach. International Journal of Microbiology, 2022, Article 2598963. https://doi.org/10.1155/2022/2598963
  5. Arias, D., Cisternas, L. A., Miranda, C., & Rivas, M. (2019). Bioprospecting of ureolytic bacteria from Laguna Salada for biomineralization applications. Frontiers in Bioengineering and Biotechnology, 6, Article 209. https://doi.org/10.3389/fbioe.2018.00209
  6. Arya, C. F., Augustine, J., Parengal, H., & Ravindran, A. D. (2016). Microbial geotechnology: Evaluation of strength and structural properties of microbial stabilized mud block (MSMB). International Journal of Scientific & Engineering Research, 7(1), 278.
  7. Barka, E. A., Vatsa, P., Sanchez, L., Gaveau-Vaillant, N., Jacquard, C., Klenk, H.-P., Clément, C., Ouhdouch, Y., & van Wezel, G. P. (2016). Taxonomy, physiology, and natural products of Actinobacteria. Microbiology and Molecular Biology Reviews, 80(1), 1–43. https://doi.org/10.1128/MMBR.00019-15
  8. Bhavana, M., Talluri, V. S. S. L. P., Kandula, S. K., & Rajagopal, S. V. (2014). Optimization of culture conditions of Streptomyces carpaticus (MTCC-11062) for the production of antimicrobial compound. International Journal of Pharmacy and Pharmaceutical Sciences, 6(8), 281–285.
  9. Bindschedler, S., Millière, L., Cailleau, G., Job, D., & Verrecchia, E. P. (2010). Calcitic nanofibres in soils and caves: A putative fungal contribution to carbonatogenesis. Geological Society, London, Special Publications, 336(1), 225–238. https://doi.org/10.1144/SP336.11
  10. Cañaveras, J. C., Cuezva, S., Sanchez-Moral, S., Lario, J., Laiz, L., Gonzalez, J. M., & Saiz-Jimenez, C. (2006). On the origin of fiber calcite crystals in moonmilk deposits. Naturwissenschaften, 93(1), 27–32. https://doi.org/10.1007/s00114-005-0052-3
  11. Cañaveras, J. C., Hoyos, M., Sánchez-Moral, S., Sanz-Rubio, E., Bedoya, J., Soler, V., Groth, I., Schumann, P., Laiz, L., González, I., & Saiz-Jimenez, C. (1999). Microbial communities associated with hydromagnesite and needle-fiber aragonite deposits in a karstic cave (Altamira, Northern Spain). Geomicrobiology Journal, 16(1), 9–25. https://doi.org/10.1080/014904599270712
  12. Dhami, N. K., Reddy, M. S., & Mukherjee, A. (2013). Biomineralization of calcium carbonates and their engineered applications: A review. Frontiers in Microbiology, 4, Article 314. https://doi.org/10.3389/fmicb.2013.00314
  13. Dupraz, C., Reid, R. P., Braissant, O., Decho, A. W., Norman, R. S., & Visscher, P. T. (2009). Processes of carbonate precipitation in modern microbial mats. Earth-Science Reviews, 96(3), 141–162. https://doi.org/10.1016/j.earscirev.2008.10.005
  14. Ferral Pérez, H., & Galicia García, M. (2020). Bioprecipitation of calcium carbonate by Bacillus subtilis and its potential to self-healing in cement-based materials. Journal of Applied Research and Technology, 18(5), 245–258. https://doi.org/10.22201/icat.24486736e.2020.18.5.1280
  15. Gollapudi, U. K., Knutson, C. L., Bang, S. S., & Islam, M. R. (1995). A new method for controlling leaching through permeable channels. Chemosphere, 30(4), 695–705. https://doi.org/10.1016/0045-6535(94)00435-W
  16. Goodfellow, M., Kämpfer, P., Busse, H.-J., Trujillo, M. E., Suzuki, K., Ludwig, W., & Whitman, W. B. (Eds.). (2012). Bergey’s manual of systematic bacteriology: Vol. 5. The Actinobacteria (2nd ed.). Springer. https://doi.org/10.1007/978-0-387-68233-4
  17. Ivanov, V., & Chu, J. (2008). Applications of microorganisms to geotechnical engineering for bioclogging and biocementation of soil in situ. Reviews in Environmental Science and Bio/Technology, 7(2), 139–153. https://doi.org/10.1007/s11157-007-9126-3
  18. Kim, H. J., Eom, H. J., Park, C., Jung, J., Shin, B., Kim, W., Chung, N., Choi, I.-G., & Park, W. (2016). Calcium carbonate precipitation by Bacillus and Sporosarcina strains isolated from concrete and analysis of the bacterial community of concrete. Journal of Microbiology and Biotechnology, 26(3), 540–548. https://doi.org/10.4014/jmb.1511.11008
  19. Ko, J. H., Xu, Q., & Jang, Y.-C. (2015). Emissions and control of hydrogen sulfide at landfills: A review. Critical Reviews in Environmental Science and Technology, 45(19), 2043–2083. https://doi.org/10.1080/10643389.2015.1010427
  20. Kontro, M., Lignell, U., Hirvonen, M.-R., & Nevalainen, A. (2005). pH effects on 10 Streptomyces spp. growth and sporulation depend on nutrients. Letters in Applied Microbiology, 41(1), 32–38. https://doi.org/10.1111/j.1472-765X.2005.01727.x
  21. Krishna Kumari, Aishwarya, A., & Sweetlin, R. (2021). Soil stabilization by bacterial cementation. Journal of Emerging Technologies and Innovative Research, 8(4), 188–196. https://www.jetir.org/papers/JETIRES06037.pdf
  22. Li, X., Chopp, D. L., Russin, W. A., Brannon, P. T., Parsek, M. R., & Packman, A. I. (2015). Spatial patterns of carbonate biomineralization in biofilms. Applied and Environmental Microbiology, 81(21), 7403–7410. https://doi.org/10.1128/AEM.01585-15
  23. Long, Y., Fang, Y., Shen, D., Feng, H., & Chen, T. (2016). Hydrogen sulfide (H₂S) emission control by aerobic sulfate reduction in landfill. Scientific Reports, 6, Article 38103. https://doi.org/10.1038/srep38103
  24. Maciejewska, M., Adam, D., Naômé, A., Martinet, L., Tenconi, E., Całusińska, M., Delfosse, P., Hanikenne, M., Baurain, D., Compère, P., Carnol, M., Barton, H. A., & Rigali, S. (2017). Assessment of the potential role of Streptomyces in cave moonmilk formation. Frontiers in Microbiology, 8, Article 1181. https://doi.org/10.3389/fmicb.2017.01181
  25. Mahanty, B., Kim, S., & Kim, C. G. (2013). Assessment of a biostimulated or bioaugmented calcification system with Bacillus pasteurii in a simulated soil environment. Microbial Ecology, 65(3), 679–688. https://doi.org/10.1007/s00248-012-0137-4
  26. Pridham, T. G., & Gottlieb, D. (1948). The utilization of carbon compounds by some Actinomycetales as an aid for species determination. Journal of Bacteriology, 56(1), 107–114. https://doi.org/10.1128/JB.56.1.107-114.1948
  27. Rajasekar, A., Moy, C. K. S., Wilkinson, S., & Sekar, R. (2021). Microbially induced calcite precipitation performance of multiple landfill indigenous bacteria compared to a commercially available bacteria in porous media. PLOS ONE, 16(7), Article e0254676. https://doi.org/10.1371/journal.pone.0254676
  28. Rajasekar, A., Wilkinson, S., Sekar, R., Bridge, J., Medina-Roldán, E., & Moy, C. K. S. (2018). Biomineralisation performance of bacteria isolated from a landfill in China. Canadian Journal of Microbiology, 64(12), 945–953. https://doi.org/10.1139/cjm-2018-0254
  29. Rusznyák, A., Akob, D. M., Nietzsche, S., Eusterhues, K., Totsche, K. U., Neu, T. R., Frosch, T., Popp, J., Keiner, R., Geletneky, J., Katzschmann, L., Schulze, E.-D., & Küsel, K. (2012). Calcite biomineralization by bacterial isolates from the recently discovered pristine karstic Herrenberg cave. Applied and Environmental Microbiology, 78(4), 1157–1167. https://doi.org/10.1128/AEM.06568-11
  30. Sánchez-Navas, A., Martín-Algarra, A., Rivadeneyra, M. A., Melchor, S., & Martín-Ramos, J. D. (2009). Crystal-growth behavior in Ca–Mg carbonate bacterial spherulites. Crystal Growth & Design, 9(6), 2690–2699. https://doi.org/10.1021/cg801320p
  31. Seifan, M., Samani, A. K., & Berenjian, A. (2016). Induced calcium carbonate precipitation using Bacillus species. Applied Microbiology and Biotechnology, 100(23), 9895–9906. https://doi.org/10.1007/s00253-016-7701-7
  32. Smith, E. W., & Austin, G. S. (1989). Adobe, pressed-earth, and rammed-earth industries in New Mexico (Bulletin 127). New Mexico Bureau of Mines & Mineral Resources. https://doi.org/10.58799/B-127
  33. Tsuchida, D., Kajihara, Y., Shimidzu, N., Hamamura, K., & Nagase, M. (2011). Hydrogen sulfide production by sulfate-reducing bacteria utilizing additives eluted from plastic resins. Waste Management & Research, 29(6), 594–601. https://doi.org/10.1177/0734242X10388556
  34. Yoshida, N., Higashimura, E., & Saeki, Y. (2010). Catalytic biomineralization of fluorescent calcite by the thermophilic bacterium Geobacillus thermoglucosidasius. Applied and Environmental Microbiology, 76(21), 7322–7327. https://doi.org/10.1128/AEM.01767-10
  35. Yun, T. Y., Feng, R. J., Zhou, D. B., Pan, Y. Y., Chen, Y. F., Wang, F., Yin, L. Y., Zhang, Y. D., & Xie, J. H. (2018). Optimization of fermentation conditions through response surface methodology for enhanced antibacterial metabolite production by Streptomyces sp. 1-14 from cassava rhizosphere. PLOS ONE, 13(11), Article e0206497. https://doi.org/10.1371/journal.pone.0206497

Related articles

Selected by shared keywords and research domain.

Open Access & Licensing

This is an open access article published by DLCARD and distributed under the terms of the CC BY 4.0 licence. You are free to read, download and share it, provided the original work is properly cited.